Review



cell lines hek 293t cell line american type culture collection cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC cell lines hek 293t cell line american type culture collection cat
    Cell Lines Hek 293t Cell Line American Type Culture Collection Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 38021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm41923624-241-132-138
    Average 99 stars, based on 38021 article reviews
    cell lines hek 293t cell line american type culture collection cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: A fine-tuned azobenzene for enhanced photopharmacology in vivo.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains AAV9-EF1a-FLEX-SNAPmGluR2WPRE-hGH Acosta-Ruiz et al. 2020 N/A AAV9-pCAG-FLEX-EGFP-WPRE Oh et al. 2014 Addgene Cat#51502-AAV9 Chemicals, peptides, and recombinant proteins DIPEA Roth Cat#4105.1 DBU Roth Cat#6869.1 DMF Roth Cat#5921.1 DMSO Roth Cat#7029.1 Formic acid Merck Cat#5.33002.0050 TFA Acros TCI Cat#139721000 Cat#T0431 TSTU Roth Cat#2130.2 HBTU Roth Cat#2132.3 MeCN VWR Cat#83640.320 (((9H-Fluoren-9-yl)methoxy)carbonyl-Dglutamic acid ChemCruz Cat#sc-485525 Fmoc-Lys-Cy3 Acosta-Ruiz et al. 2020 N/A Fmoc-Lys-Cy5 Acosta-Ruiz et al. 2020 N/A THF VWR Cat#457071000 XPhos Pd G2 Aldrich Cat#741825-1g Cs2CO3 Roth Cat#6873.2 4-iodoaniline Aldrich Cat#129364-25g nitrosobenzene Aldrich Cat#N24609-10g acetyl chloride Aldrich Cat#114189-25g NaH, 60% in mineral oil Aldrich Cat#452912-100g methyl iodide Aldrich Cat#67692-100mL 2-azetidinone CAS: 930-21-2 Acros Cat#930212-1g 2-pyrrolidinone CAS: 616-45-5 TCI Cat#616455-25g delta-valerolactam CAS: 675-20-7 TCI Cat#675207-25g epsilon-caprolactam CAS: 105-60-2 TCI Cat#105602-25g phosgene, 15% Aldrich Cat#748684-100mL methylamine hydrochloride CAS: 593-51-1 Aldrich Cat#593511-100g 1,1-dimethylurea CAS: 598-94-7 Acros Cat#598947-5g 1,1,3-trimethylurea CAS: 632-14-4 Alfa Aesar Cat#632144-1g 1-methyl-2-imidaolidinone CAS: 694-32-6 Acros Cat#694326-500mg 1,3-dimethylurea CAS: 96-31-1 TCI Cat#96311-25g ethylene diamine Roth Cat#4218.1 FmocNHPEG12COOH broadpharm Cat#BP-21632 BG-COOH Levitz et al. 2017 N/A BGAG12,400 this study N/A 2xBGAG12,400 this study N/A BGAG12,400-Cy3 this study N/A BGAG12,400-Cy5 this study N/A BGAG12,400-Cy3 v2 this study N/A BGAG12,400-Cy5 v2 this study N/A BGAG12-Cy5 Acosta-Ruiz et al. 2020 N/A (Continued on next page) e1 Cell Chemical Biology 28, 1648–1663.e1–e16, November 18, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER 2xBGAG12 Acosta-Ruiz et al. 2020 N/A BGAG12 Broichhagen et al., 2015a N/A 4,4’-diamino azobenzene Acros Cat#ACRO401580250 butyryl chloride Aldrich Cat#236349-50g ethyl isocyanate Aldrich Cat#E33300-5g NaCl MilliporeSigma Cat#S5886-1KG HEPES MilliporeSigma Cat#H4034-500G Na+ ascorbate MilliporeSigma Cat#A7631-100G Thiourea MilliporeSigma Cat#T8656-100G Na+ pyruvate MilliporeSigma Cat#P2256-100G CaCl2.2H2O MilliporeSigma Cat#C3881-500G NMDG MilliporeSigma Cat#M2004-1KG K-Gluconate MilliporeSigma Cat#PHR1130-1G phosphocreatine-Na2 MilliporeSigma Cat#P7936-1G MgATP MilliporeSigma Cat#A9187-500MG Na2- GTP MilliporeSigma Cat#G8877-25MG biocytin MilliporeSigma Cat#B4261-250MG SNAP-Surface Alexa Fluor 546 New England Biolabs Cat#S9132S Lipofectamine 2000 Invitrogen Cat#11668027 Trypsin Sigma-Aldrich Cat# T1763 DMEM/F12 Sigma-Aldrich Cat# 6421 DMEM Gibco Cat# 41965-039 FBS Dutscher Cat# S1900-500 Penicillin-Streptomycin Gibco Cat# 15140-122 Trypsin-EDTA Gibco Cat# 25300-054 Glutamine Gibco Cat# 25030-081 Dexamethasone Sigma-Aldrich Cat# D4902 HEPES Gibco Cat# 15630-080 Experimental models: cell lines HEK 293T Cells American Type Culture Collection (ATCC) CatCRL-3216; Cat#CR-11268 Experimental models: organisms/strains Mouse: STOCK Tg(Grm2-cre)MR90Gsat/ Mmucd Mus musculus Mutant Mouse Resource & Research Center MMRRC Cat# 034611-UCD Oligonucleotides Primer SNAP-mGluR2-mGluR1 Fwd1: TCTTCCACCCTGTAAAGATCCCA CACTCCTGCC This paper N/A Primer SNAP-mGluR2-mGluR1 Rev1: GCTCCACTCAAGATACTCCTGAGG CAGCTCAAAG This paper N/A Primer SNAP-mGluR2-mGluR1 Fwd2: GAGCTGCCTCAGGAGTATCTTGAGT GGAGCAACATC This paper N/A Primer SNAP-mGluR2-mGluR1 Rev2: AGGAGTGTGGGATCTTTACAGGG TGGAAGAGCTTTG This paper N/A Recombinant DNA SNAP-mGluR2 Doumazane et al., 2011 N/A GIRK1-F137S Vivaudou et al., 1997 N/A SNAP-mGluR2-mGluR5 Acosta-Ruiz et al., 2020 N/A SNAP-mGluR2-mGluR1 This paper N/A (Continued on next page) ll Resource Cell Chemical Biology 28, 1648–1663.e1–e16, November 18, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER CMV-GCaMP6f Chen et al., 2013 Addgene Cat#40755 pCIKv1.1 Lesage et al., 1992 N/A Software and algorithms Fiji/ImageJ, v1.8 Schindelin et al., 2012 https://imagej.nih.gov/ij/ Prism GraphPad https://graphpad.com Clampex Molecular Devices https://www.moleculardevices.com Clampfit Molecular Devices https://www.moleculardevices.com Origin Origin Lab Corporation https://www.originlab.com/, RRID:SCR_002815 Microsoft Excel Microsoft Office https://products.office.com/en-us/excel Doric Neuroscience Studio Doric Lenses http://doriclenses.com/life-sciences/ software/955-doric-neurosciencestudio.html SMART Video Tracking System Harvard Apparatus https://www.harvardapparatus.com/ smart-video-tracking-system.html SigmaPlot Systat Software, inc. https://systatsoftware.com/products/ sigmaplot/ Other CoolLED pE4000 CoolLED https://www.coolled.com/products/ pe-4000/ Doric Combined LEDs: 4-LED Model Doric LEDC4_385/465/515/625 ll Resource



    Similar Products

    99
    ATCC cell lines hek 293t cell line american type culture collection cat
    Cell Lines Hek 293t Cell Line American Type Culture Collection Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm41923624-241-132-138
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t cell line american type culture collection cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek 293t american type culture collection
    Cell Lines Hek 293t American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm40811062-235-207-210
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t american type culture collection - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell line tissue hek 293t american type culture collection
    Cell Line Tissue Hek 293t American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm40374929-1110-5-9
    Average 99 stars, based on 1 article reviews
    cell line tissue hek 293t american type culture collection - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines human embryonic kidney hek 293t american type culture collection
    Cell Lines Human Embryonic Kidney Hek 293t American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm40067824-75-144-151
    Average 99 stars, based on 1 article reviews
    cell lines human embryonic kidney hek 293t american type culture collection - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek 293t american type culture collection crl 3216 tcrb
    Cell Lines Hek 293t American Type Culture Collection Crl 3216 Tcrb, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm39731734-257-66-69
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t american type culture collection crl 3216 tcrb - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek 293t american type culture collection cat
    Cell Lines Hek 293t American Type Culture Collection Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm37128605-156-41-45
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t american type culture collection cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek293t cells american type culture collection crl 11268 hek 293t hace2
    Cell Lines Hek293t Cells American Type Culture Collection Crl 11268 Hek 293t Hace2, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T%2F17/pm35973428-140-161-165
    Average 99 stars, based on 1 article reviews
    cell lines hek293t cells american type culture collection crl 11268 hek 293t hace2 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines hek 293t 17 cells american type culture collection
    Cell Lines Hek 293t 17 Cells American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T%2F17/pmc09212999__mmc2-105-72-77
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t 17 cells american type culture collection - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    94
    ATCC cell lines hek 293t cells american type culture collection
    Cell Lines Hek 293t Cells American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/Fusarium+lateritium+Nees/pm33735619-661-118-123
    Average 94 stars, based on 1 article reviews
    cell lines hek 293t cells american type culture collection - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    99
    ATCC embryonic kidney hek cell line 293t american type culture collection
    Embryonic Kidney Hek Cell Line 293t American Type Culture Collection, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hek+293t+cells+american+type+culture+collection/293T/pm20883731-49-3-9
    Average 99 stars, based on 1 article reviews
    embryonic kidney hek cell line 293t american type culture collection - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results